ID: 1067032476

View in Genome Browser
Species Human (GRCh38)
Location 10:42887562-42887584
Sequence AACCCTTGTCTACTTTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067032476_1067032479 25 Left 1067032476 10:42887562-42887584 CCCATCAAAAGTAGACAAGGGTT No data
Right 1067032479 10:42887610-42887632 ATTTGTTATTGCCTGTCTTTTGG 0: 496
1: 863
2: 811
3: 523
4: 760

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067032476 Original CRISPR AACCCTTGTCTACTTTTGAT GGG (reversed) Intergenic
No off target data available for this crispr