ID: 1067032728

View in Genome Browser
Species Human (GRCh38)
Location 10:42889217-42889239
Sequence AAGGAGAGTGCAGTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067032728_1067032735 19 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032735 10:42889259-42889281 CCATGCCACAGGACCACTACTGG No data
1067032728_1067032733 8 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032733 10:42889248-42889270 GCACAGATTTTCCATGCCACAGG No data
1067032728_1067032737 21 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032737 10:42889261-42889283 ATGCCACAGGACCACTACTGGGG No data
1067032728_1067032736 20 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032736 10:42889260-42889282 CATGCCACAGGACCACTACTGGG No data
1067032728_1067032739 26 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032739 10:42889266-42889288 ACAGGACCACTACTGGGGAGTGG No data
1067032728_1067032740 29 Left 1067032728 10:42889217-42889239 CCCATAATCACTGCACTCTCCTT No data
Right 1067032740 10:42889269-42889291 GGACCACTACTGGGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067032728 Original CRISPR AAGGAGAGTGCAGTGATTAT GGG (reversed) Intergenic
No off target data available for this crispr