ID: 1067035616

View in Genome Browser
Species Human (GRCh38)
Location 10:42914318-42914340
Sequence GTGTGTAGAGGGAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067035616_1067035624 30 Left 1067035616 10:42914318-42914340 CCTTGCACCTTCCCTCTACACAC No data
Right 1067035624 10:42914371-42914393 AACCAAAGGAGAACTCTCATAGG No data
1067035616_1067035623 16 Left 1067035616 10:42914318-42914340 CCTTGCACCTTCCCTCTACACAC No data
Right 1067035623 10:42914357-42914379 ATAATGTAAGAGGCAACCAAAGG No data
1067035616_1067035620 6 Left 1067035616 10:42914318-42914340 CCTTGCACCTTCCCTCTACACAC No data
Right 1067035620 10:42914347-42914369 AAACCCTAGAATAATGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067035616 Original CRISPR GTGTGTAGAGGGAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr