ID: 1067037691

View in Genome Browser
Species Human (GRCh38)
Location 10:42932207-42932229
Sequence ACGGTGACCACGCAGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067037691_1067037703 14 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037703 10:42932244-42932266 AGGGCACCTTGAAGTAAGGCAGG No data
1067037691_1067037699 -5 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037699 10:42932225-42932247 ACCGTGATCAGGGCGGGCCAGGG No data
1067037691_1067037705 20 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037691_1067037701 10 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037701 10:42932240-42932262 GGCCAGGGCACCTTGAAGTAAGG No data
1067037691_1067037707 28 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037707 10:42932258-42932280 TAAGGCAGGACAAGGAGGCCCGG No data
1067037691_1067037706 23 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037706 10:42932253-42932275 TGAAGTAAGGCAGGACAAGGAGG No data
1067037691_1067037698 -6 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037698 10:42932224-42932246 CACCGTGATCAGGGCGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067037691 Original CRISPR ACGGTGACCACGCAGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr