ID: 1067037692

View in Genome Browser
Species Human (GRCh38)
Location 10:42932213-42932235
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067037692_1067037705 14 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037692_1067037701 4 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037701 10:42932240-42932262 GGCCAGGGCACCTTGAAGTAAGG No data
1067037692_1067037706 17 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037706 10:42932253-42932275 TGAAGTAAGGCAGGACAAGGAGG No data
1067037692_1067037708 25 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037708 10:42932261-42932283 GGCAGGACAAGGAGGCCCGGAGG No data
1067037692_1067037707 22 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037707 10:42932258-42932280 TAAGGCAGGACAAGGAGGCCCGG No data
1067037692_1067037703 8 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037703 10:42932244-42932266 AGGGCACCTTGAAGTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067037692 Original CRISPR CTGATCACGGTGACCACGCA GGG (reversed) Intergenic
No off target data available for this crispr