ID: 1067037700

View in Genome Browser
Species Human (GRCh38)
Location 10:42932226-42932248
Sequence GCCCTGGCCCGCCCTGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067037700_1067037710 26 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037710 10:42932275-42932297 GCCCGGAGGCCATGAGCTGTGGG No data
1067037700_1067037705 1 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037700_1067037706 4 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037706 10:42932253-42932275 TGAAGTAAGGCAGGACAAGGAGG No data
1067037700_1067037713 29 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037713 10:42932278-42932300 CGGAGGCCATGAGCTGTGGGAGG No data
1067037700_1067037714 30 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037714 10:42932279-42932301 GGAGGCCATGAGCTGTGGGAGGG No data
1067037700_1067037709 25 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037709 10:42932274-42932296 GGCCCGGAGGCCATGAGCTGTGG No data
1067037700_1067037707 9 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037707 10:42932258-42932280 TAAGGCAGGACAAGGAGGCCCGG No data
1067037700_1067037703 -5 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037703 10:42932244-42932266 AGGGCACCTTGAAGTAAGGCAGG No data
1067037700_1067037708 12 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037708 10:42932261-42932283 GGCAGGACAAGGAGGCCCGGAGG No data
1067037700_1067037701 -9 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037701 10:42932240-42932262 GGCCAGGGCACCTTGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067037700 Original CRISPR GCCCTGGCCCGCCCTGATCA CGG (reversed) Intergenic
No off target data available for this crispr