ID: 1067037705

View in Genome Browser
Species Human (GRCh38)
Location 10:42932250-42932272
Sequence CCTTGAAGTAAGGCAGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067037693_1067037705 13 Left 1067037693 10:42932214-42932236 CCTGCGTGGTCACCGTGATCAGG No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037700_1067037705 1 Left 1067037700 10:42932226-42932248 CCGTGATCAGGGCGGGCCAGGGC No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037691_1067037705 20 Left 1067037691 10:42932207-42932229 CCTGGGCCCTGCGTGGTCACCGT No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data
1067037692_1067037705 14 Left 1067037692 10:42932213-42932235 CCCTGCGTGGTCACCGTGATCAG No data
Right 1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067037705 Original CRISPR CCTTGAAGTAAGGCAGGACA AGG Intergenic
No off target data available for this crispr