ID: 1067037882

View in Genome Browser
Species Human (GRCh38)
Location 10:42932966-42932988
Sequence CCCGCTGAGACTGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067037882_1067037899 19 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037899 10:42933008-42933030 CCTGGGGGAATGCTGCGCTCTGG No data
1067037882_1067037894 3 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037894 10:42932992-42933014 CGGCTTAGTCCGGCACCCTGGGG No data
1067037882_1067037893 2 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037893 10:42932991-42933013 CCGGCTTAGTCCGGCACCCTGGG No data
1067037882_1067037890 -7 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037890 10:42932982-42933004 CAGCGGGTTCCGGCTTAGTCCGG No data
1067037882_1067037900 23 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037900 10:42933012-42933034 GGGGAATGCTGCGCTCTGGCTGG No data
1067037882_1067037891 1 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037891 10:42932990-42933012 TCCGGCTTAGTCCGGCACCCTGG No data
1067037882_1067037895 4 Left 1067037882 10:42932966-42932988 CCCGCGCCCCCAGTCTCAGCGGG No data
Right 1067037895 10:42932993-42933015 GGCTTAGTCCGGCACCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067037882 Original CRISPR CCCGCTGAGACTGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr