ID: 1067038114

View in Genome Browser
Species Human (GRCh38)
Location 10:42933868-42933890
Sequence GTGCCTGGGCACGGCGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067038114_1067038125 18 Left 1067038114 10:42933868-42933890 CCCCGCACGCCGTGCCCAGGCAC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038114_1067038120 0 Left 1067038114 10:42933868-42933890 CCCCGCACGCCGTGCCCAGGCAC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067038114 Original CRISPR GTGCCTGGGCACGGCGTGCG GGG (reversed) Intergenic