ID: 1067038114 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:42933868-42933890 |
Sequence | GTGCCTGGGCACGGCGTGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067038114_1067038120 | 0 | Left | 1067038114 | 10:42933868-42933890 | CCCCGCACGCCGTGCCCAGGCAC | No data | ||
Right | 1067038120 | 10:42933891-42933913 | TTCCTCCCCAACACAAGCAAAGG | No data | ||||
1067038114_1067038125 | 18 | Left | 1067038114 | 10:42933868-42933890 | CCCCGCACGCCGTGCCCAGGCAC | No data | ||
Right | 1067038125 | 10:42933909-42933931 | AAAGGTAGCCCAGCTGCAGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067038114 | Original CRISPR | GTGCCTGGGCACGGCGTGCG GGG (reversed) | Intergenic | ||