ID: 1067038120

View in Genome Browser
Species Human (GRCh38)
Location 10:42933891-42933913
Sequence TTCCTCCCCAACACAAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067038109_1067038120 23 Left 1067038109 10:42933845-42933867 CCTGCACCTGCGGCTTCCCTGCA No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038116_1067038120 -2 Left 1067038116 10:42933870-42933892 CCGCACGCCGTGCCCAGGCACTT No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038112_1067038120 6 Left 1067038112 10:42933862-42933884 CCTGCACCCCGCACGCCGTGCCC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038111_1067038120 7 Left 1067038111 10:42933861-42933883 CCCTGCACCCCGCACGCCGTGCC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038115_1067038120 -1 Left 1067038115 10:42933869-42933891 CCCGCACGCCGTGCCCAGGCACT No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038110_1067038120 17 Left 1067038110 10:42933851-42933873 CCTGCGGCTTCCCTGCACCCCGC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038117_1067038120 -9 Left 1067038117 10:42933877-42933899 CCGTGCCCAGGCACTTCCTCCCC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data
1067038114_1067038120 0 Left 1067038114 10:42933868-42933890 CCCCGCACGCCGTGCCCAGGCAC No data
Right 1067038120 10:42933891-42933913 TTCCTCCCCAACACAAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067038120 Original CRISPR TTCCTCCCCAACACAAGCAA AGG Intergenic