ID: 1067038125

View in Genome Browser
Species Human (GRCh38)
Location 10:42933909-42933931
Sequence AAAGGTAGCCCAGCTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067038118_1067038125 4 Left 1067038118 10:42933882-42933904 CCCAGGCACTTCCTCCCCAACAC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038116_1067038125 16 Left 1067038116 10:42933870-42933892 CCGCACGCCGTGCCCAGGCACTT No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038112_1067038125 24 Left 1067038112 10:42933862-42933884 CCTGCACCCCGCACGCCGTGCCC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038115_1067038125 17 Left 1067038115 10:42933869-42933891 CCCGCACGCCGTGCCCAGGCACT No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038111_1067038125 25 Left 1067038111 10:42933861-42933883 CCCTGCACCCCGCACGCCGTGCC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038119_1067038125 3 Left 1067038119 10:42933883-42933905 CCAGGCACTTCCTCCCCAACACA No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038122_1067038125 -10 Left 1067038122 10:42933896-42933918 CCCCAACACAAGCAAAGGTAGCC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038114_1067038125 18 Left 1067038114 10:42933868-42933890 CCCCGCACGCCGTGCCCAGGCAC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038121_1067038125 -7 Left 1067038121 10:42933893-42933915 CCTCCCCAACACAAGCAAAGGTA No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data
1067038117_1067038125 9 Left 1067038117 10:42933877-42933899 CCGTGCCCAGGCACTTCCTCCCC No data
Right 1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067038125 Original CRISPR AAAGGTAGCCCAGCTGCAGC CGG Intergenic