ID: 1067038714

View in Genome Browser
Species Human (GRCh38)
Location 10:42936971-42936993
Sequence CTGGGAGACCATAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067038704_1067038714 -2 Left 1067038704 10:42936950-42936972 CCGACCTGTACCCTGGGACACCT No data
Right 1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG No data
1067038702_1067038714 2 Left 1067038702 10:42936946-42936968 CCACCCGACCTGTACCCTGGGAC No data
Right 1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG No data
1067038703_1067038714 -1 Left 1067038703 10:42936949-42936971 CCCGACCTGTACCCTGGGACACC No data
Right 1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG No data
1067038699_1067038714 10 Left 1067038699 10:42936938-42936960 CCACAATTCCACCCGACCTGTAC No data
Right 1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG No data
1067038707_1067038714 -6 Left 1067038707 10:42936954-42936976 CCTGTACCCTGGGACACCTGGGA No data
Right 1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067038714 Original CRISPR CTGGGAGACCATAGGGAAGT GGG Intergenic
No off target data available for this crispr