ID: 1067039971

View in Genome Browser
Species Human (GRCh38)
Location 10:42944800-42944822
Sequence AACACACTATAGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067039967_1067039971 11 Left 1067039967 10:42944766-42944788 CCGTTTTAAAAGCTATACAAAAA No data
Right 1067039971 10:42944800-42944822 AACACACTATAGGCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067039971 Original CRISPR AACACACTATAGGCTGGGCA TGG Intergenic
No off target data available for this crispr