ID: 1067041282

View in Genome Browser
Species Human (GRCh38)
Location 10:42954504-42954526
Sequence CCGAGCAGTCTAGTGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067041282_1067041295 20 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041295 10:42954547-42954569 CAAGCTAGCCTGAGTGCGGAAGG No data
1067041282_1067041290 -4 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041290 10:42954523-42954545 TCGGGTTTCCTGGAGGCTCCGGG No data
1067041282_1067041296 23 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041296 10:42954550-42954572 GCTAGCCTGAGTGCGGAAGGTGG No data
1067041282_1067041293 16 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041293 10:42954543-42954565 GGGCCAAGCTAGCCTGAGTGCGG No data
1067041282_1067041297 27 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041297 10:42954554-42954576 GCCTGAGTGCGGAAGGTGGCAGG No data
1067041282_1067041289 -5 Left 1067041282 10:42954504-42954526 CCAGCCCTCACTAGACTGCTCGG No data
Right 1067041289 10:42954522-42954544 CTCGGGTTTCCTGGAGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067041282 Original CRISPR CCGAGCAGTCTAGTGAGGGC TGG (reversed) Intergenic