ID: 1067043848

View in Genome Browser
Species Human (GRCh38)
Location 10:42973627-42973649
Sequence AAGAGGGAGGTGCGTACAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067043848_1067043850 -8 Left 1067043848 10:42973627-42973649 CCGCTTGTACGCACCTCCCTCTT No data
Right 1067043850 10:42973642-42973664 TCCCTCTTCTCTGTCTCATCAGG No data
1067043848_1067043852 -7 Left 1067043848 10:42973627-42973649 CCGCTTGTACGCACCTCCCTCTT No data
Right 1067043852 10:42973643-42973665 CCCTCTTCTCTGTCTCATCAGGG No data
1067043848_1067043854 0 Left 1067043848 10:42973627-42973649 CCGCTTGTACGCACCTCCCTCTT No data
Right 1067043854 10:42973650-42973672 CTCTGTCTCATCAGGGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067043848 Original CRISPR AAGAGGGAGGTGCGTACAAG CGG (reversed) Intergenic
No off target data available for this crispr