ID: 1067044869

View in Genome Browser
Species Human (GRCh38)
Location 10:42979899-42979921
Sequence TGTGAGAAGCAGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067044864_1067044869 17 Left 1067044864 10:42979859-42979881 CCTCAGTTGCTATGACAACTAAT No data
Right 1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG No data
1067044863_1067044869 21 Left 1067044863 10:42979855-42979877 CCTGCCTCAGTTGCTATGACAAC No data
Right 1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG No data
1067044862_1067044869 22 Left 1067044862 10:42979854-42979876 CCCTGCCTCAGTTGCTATGACAA No data
Right 1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067044869 Original CRISPR TGTGAGAAGCAGCATGAGGA GGG Intergenic
No off target data available for this crispr