ID: 1067047588

View in Genome Browser
Species Human (GRCh38)
Location 10:42993209-42993231
Sequence CAGGCTCTGCCTCCCGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047588_1067047599 30 Left 1067047588 10:42993209-42993231 CCTGGGACGGGAGGCAGAGCCTG No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047588_1067047597 28 Left 1067047588 10:42993209-42993231 CCTGGGACGGGAGGCAGAGCCTG No data
Right 1067047597 10:42993260-42993282 ATCTCCCCACTCTGTGTACATGG No data
1067047588_1067047598 29 Left 1067047588 10:42993209-42993231 CCTGGGACGGGAGGCAGAGCCTG No data
Right 1067047598 10:42993261-42993283 TCTCCCCACTCTGTGTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047588 Original CRISPR CAGGCTCTGCCTCCCGTCCC AGG (reversed) Intergenic
No off target data available for this crispr