ID: 1067047592

View in Genome Browser
Species Human (GRCh38)
Location 10:42993237-42993259
Sequence GGAAGTACAGGGAAAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047592_1067047604 6 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047604 10:42993266-42993288 CCACTCTGTGTACATGGGGTGGG No data
1067047592_1067047597 0 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047597 10:42993260-42993282 ATCTCCCCACTCTGTGTACATGG No data
1067047592_1067047599 2 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047592_1067047598 1 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047598 10:42993261-42993283 TCTCCCCACTCTGTGTACATGGG No data
1067047592_1067047602 5 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047592_1067047605 18 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047592 Original CRISPR GGAAGTACAGGGAAAAGGAC AGG (reversed) Intergenic