ID: 1067047594

View in Genome Browser
Species Human (GRCh38)
Location 10:42993248-42993270
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047594_1067047598 -10 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047598 10:42993261-42993283 TCTCCCCACTCTGTGTACATGGG No data
1067047594_1067047604 -5 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047604 10:42993266-42993288 CCACTCTGTGTACATGGGGTGGG No data
1067047594_1067047599 -9 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047594_1067047606 21 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047606 10:42993292-42993314 CAAAGCTGGCGCTTACACCATGG No data
1067047594_1067047605 7 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047594_1067047602 -6 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047594 Original CRISPR AGTGGGGAGATGGAAGTACA GGG (reversed) Intergenic
No off target data available for this crispr