ID: 1067047596 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:42993258-42993280 |
| Sequence | ATGTACACAGAGTGGGGAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067047596_1067047606 | 11 | Left | 1067047596 | 10:42993258-42993280 | CCATCTCCCCACTCTGTGTACAT | No data | ||
| Right | 1067047606 | 10:42993292-42993314 | CAAAGCTGGCGCTTACACCATGG | No data | ||||
| 1067047596_1067047605 | -3 | Left | 1067047596 | 10:42993258-42993280 | CCATCTCCCCACTCTGTGTACAT | No data | ||
| Right | 1067047605 | 10:42993278-42993300 | CATGGGGTGGGCAGCAAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067047596 | Original CRISPR | ATGTACACAGAGTGGGGAGA TGG (reversed) | Intergenic | ||