ID: 1067047599

View in Genome Browser
Species Human (GRCh38)
Location 10:42993262-42993284
Sequence CTCCCCACTCTGTGTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047593_1067047599 -3 Left 1067047593 10:42993242-42993264 CCTTTTCCCTGTACTTCCATCTC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047595_1067047599 -10 Left 1067047595 10:42993249-42993271 CCTGTACTTCCATCTCCCCACTC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047592_1067047599 2 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047588_1067047599 30 Left 1067047588 10:42993209-42993231 CCTGGGACGGGAGGCAGAGCCTG No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047590_1067047599 11 Left 1067047590 10:42993228-42993250 CCTGCAGGCCCTGTCCTTTTCCC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047594_1067047599 -9 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data
1067047591_1067047599 3 Left 1067047591 10:42993236-42993258 CCCTGTCCTTTTCCCTGTACTTC No data
Right 1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047599 Original CRISPR CTCCCCACTCTGTGTACATG GGG Intergenic
No off target data available for this crispr