ID: 1067047602

View in Genome Browser
Species Human (GRCh38)
Location 10:42993265-42993287
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047590_1067047602 14 Left 1067047590 10:42993228-42993250 CCTGCAGGCCCTGTCCTTTTCCC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047594_1067047602 -6 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047593_1067047602 0 Left 1067047593 10:42993242-42993264 CCTTTTCCCTGTACTTCCATCTC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047595_1067047602 -7 Left 1067047595 10:42993249-42993271 CCTGTACTTCCATCTCCCCACTC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047592_1067047602 5 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
1067047591_1067047602 6 Left 1067047591 10:42993236-42993258 CCCTGTCCTTTTCCCTGTACTTC No data
Right 1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047602 Original CRISPR CCCACTCTGTGTACATGGGG TGG Intergenic
No off target data available for this crispr