ID: 1067047605

View in Genome Browser
Species Human (GRCh38)
Location 10:42993278-42993300
Sequence CATGGGGTGGGCAGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067047591_1067047605 19 Left 1067047591 10:42993236-42993258 CCCTGTCCTTTTCCCTGTACTTC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047600_1067047605 -9 Left 1067047600 10:42993264-42993286 CCCCACTCTGTGTACATGGGGTG No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047601_1067047605 -10 Left 1067047601 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047594_1067047605 7 Left 1067047594 10:42993248-42993270 CCCTGTACTTCCATCTCCCCACT No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047592_1067047605 18 Left 1067047592 10:42993237-42993259 CCTGTCCTTTTCCCTGTACTTCC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047590_1067047605 27 Left 1067047590 10:42993228-42993250 CCTGCAGGCCCTGTCCTTTTCCC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047593_1067047605 13 Left 1067047593 10:42993242-42993264 CCTTTTCCCTGTACTTCCATCTC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047595_1067047605 6 Left 1067047595 10:42993249-42993271 CCTGTACTTCCATCTCCCCACTC No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data
1067047596_1067047605 -3 Left 1067047596 10:42993258-42993280 CCATCTCCCCACTCTGTGTACAT No data
Right 1067047605 10:42993278-42993300 CATGGGGTGGGCAGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067047605 Original CRISPR CATGGGGTGGGCAGCAAAGC TGG Intergenic
No off target data available for this crispr