ID: 1067048128

View in Genome Browser
Species Human (GRCh38)
Location 10:42997357-42997379
Sequence ACATGTGATCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067048128_1067048132 12 Left 1067048128 10:42997357-42997379 CCAGCTTCCCTCTGATCACATGT No data
Right 1067048132 10:42997392-42997414 ATCCCAAACCTAACCCCAGCTGG No data
1067048128_1067048133 13 Left 1067048128 10:42997357-42997379 CCAGCTTCCCTCTGATCACATGT No data
Right 1067048133 10:42997393-42997415 TCCCAAACCTAACCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067048128 Original CRISPR ACATGTGATCAGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr