ID: 1067048809

View in Genome Browser
Species Human (GRCh38)
Location 10:43000471-43000493
Sequence AGGGGCAAGTGGAAGAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067048799_1067048809 18 Left 1067048799 10:43000430-43000452 CCAGGCTCCTGTGCTCCTTCCTT No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048803_1067048809 -1 Left 1067048803 10:43000449-43000471 CCTTTCAGATGGCATTCATTGAA No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048797_1067048809 20 Left 1067048797 10:43000428-43000450 CCCCAGGCTCCTGTGCTCCTTCC No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048798_1067048809 19 Left 1067048798 10:43000429-43000451 CCCAGGCTCCTGTGCTCCTTCCT No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048796_1067048809 29 Left 1067048796 10:43000419-43000441 CCTCTACATCCCCAGGCTCCTGT No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048802_1067048809 3 Left 1067048802 10:43000445-43000467 CCTTCCTTTCAGATGGCATTCAT No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048800_1067048809 11 Left 1067048800 10:43000437-43000459 CCTGTGCTCCTTCCTTTCAGATG No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data
1067048795_1067048809 30 Left 1067048795 10:43000418-43000440 CCCTCTACATCCCCAGGCTCCTG No data
Right 1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067048809 Original CRISPR AGGGGCAAGTGGAAGAAGGA CGG Intergenic
No off target data available for this crispr