ID: 1067049239

View in Genome Browser
Species Human (GRCh38)
Location 10:43002573-43002595
Sequence AGAGTGTGCTTCAGCCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067049239_1067049245 -2 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG No data
1067049239_1067049247 6 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049247 10:43002602-43002624 CTGGAGGGCAGATGGTTTCGAGG No data
1067049239_1067049248 30 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049248 10:43002626-43002648 AACAGCCCTCAATGCCACAGAGG No data
1067049239_1067049243 -10 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049243 10:43002586-43002608 AGCACACTCTGTGGGCCTGGAGG No data
1067049239_1067049244 -9 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049244 10:43002587-43002609 GCACACTCTGTGGGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067049239 Original CRISPR AGAGTGTGCTTCAGCCTCCT AGG (reversed) Intergenic
No off target data available for this crispr