ID: 1067049245

View in Genome Browser
Species Human (GRCh38)
Location 10:43002594-43002616
Sequence CTGTGGGCCTGGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067049239_1067049245 -2 Left 1067049239 10:43002573-43002595 CCTAGGAGGCTGAAGCACACTCT No data
Right 1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067049245 Original CRISPR CTGTGGGCCTGGAGGGCAGA TGG Intergenic
No off target data available for this crispr