ID: 1067050840

View in Genome Browser
Species Human (GRCh38)
Location 10:43019351-43019373
Sequence TGGGAGCATCGCTTAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067050836_1067050840 0 Left 1067050836 10:43019328-43019350 CCCAGCTATTCGGGAGGCTGACA 0: 5
1: 472
2: 11624
3: 143660
4: 334796
Right 1067050840 10:43019351-43019373 TGGGAGCATCGCTTAAGCCCAGG No data
1067050837_1067050840 -1 Left 1067050837 10:43019329-43019351 CCAGCTATTCGGGAGGCTGACAT 0: 2
1: 81
2: 2002
3: 25161
4: 184669
Right 1067050840 10:43019351-43019373 TGGGAGCATCGCTTAAGCCCAGG No data
1067050831_1067050840 27 Left 1067050831 10:43019301-43019323 CCGGGCATGGTGGTGCATGTCTG 0: 227
1: 5221
2: 17078
3: 48416
4: 99122
Right 1067050840 10:43019351-43019373 TGGGAGCATCGCTTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067050840 Original CRISPR TGGGAGCATCGCTTAAGCCC AGG Intergenic
No off target data available for this crispr