ID: 1067051892

View in Genome Browser
Species Human (GRCh38)
Location 10:43026395-43026417
Sequence CTGTGTCACTGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067051883_1067051892 10 Left 1067051883 10:43026362-43026384 CCTGCTCCTCTGACTGTCTACCT No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051881_1067051892 17 Left 1067051881 10:43026355-43026377 CCCAATGCCTGCTCCTCTGACTG No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051880_1067051892 28 Left 1067051880 10:43026344-43026366 CCAGCACTGAACCCAATGCCTGC No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051887_1067051892 -10 Left 1067051887 10:43026382-43026404 CCTTGGCTGGTTCCTGTGTCACT No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051879_1067051892 29 Left 1067051879 10:43026343-43026365 CCCAGCACTGAACCCAATGCCTG No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051882_1067051892 16 Left 1067051882 10:43026356-43026378 CCAATGCCTGCTCCTCTGACTGT No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data
1067051885_1067051892 4 Left 1067051885 10:43026368-43026390 CCTCTGACTGTCTACCTTGGCTG No data
Right 1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067051892 Original CRISPR CTGTGTCACTGGAAGGAGGA AGG Intergenic
No off target data available for this crispr