ID: 1067051930

View in Genome Browser
Species Human (GRCh38)
Location 10:43026611-43026633
Sequence AGCAAGCTGGGTCACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067051930_1067051935 -7 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051930_1067051934 -10 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051930_1067051937 11 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051937 10:43026645-43026667 GGAGGCCGAGCAGGTGAGACTGG No data
1067051930_1067051936 2 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067051930 Original CRISPR AGCAAGCTGGGTCACCCTGA GGG (reversed) Intergenic
No off target data available for this crispr