ID: 1067051934

View in Genome Browser
Species Human (GRCh38)
Location 10:43026624-43026646
Sequence CCAGCTTGCTGACGAGCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067051926_1067051934 6 Left 1067051926 10:43026595-43026617 CCCAAGGTGCGCGGAGCCCTCAG No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051927_1067051934 5 Left 1067051927 10:43026596-43026618 CCAAGGTGCGCGGAGCCCTCAGG No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051922_1067051934 16 Left 1067051922 10:43026585-43026607 CCTTGCCATCCCCAAGGTGCGCG No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051925_1067051934 7 Left 1067051925 10:43026594-43026616 CCCCAAGGTGCGCGGAGCCCTCA No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051924_1067051934 11 Left 1067051924 10:43026590-43026612 CCATCCCCAAGGTGCGCGGAGCC No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data
1067051930_1067051934 -10 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051934 10:43026624-43026646 CCAGCTTGCTGACGAGCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067051934 Original CRISPR CCAGCTTGCTGACGAGCAAG CGG Intergenic
No off target data available for this crispr