ID: 1067051935

View in Genome Browser
Species Human (GRCh38)
Location 10:43026627-43026649
Sequence GCTTGCTGACGAGCAAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067051924_1067051935 14 Left 1067051924 10:43026590-43026612 CCATCCCCAAGGTGCGCGGAGCC No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051926_1067051935 9 Left 1067051926 10:43026595-43026617 CCCAAGGTGCGCGGAGCCCTCAG No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051922_1067051935 19 Left 1067051922 10:43026585-43026607 CCTTGCCATCCCCAAGGTGCGCG No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051927_1067051935 8 Left 1067051927 10:43026596-43026618 CCAAGGTGCGCGGAGCCCTCAGG No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051925_1067051935 10 Left 1067051925 10:43026594-43026616 CCCCAAGGTGCGCGGAGCCCTCA No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051931_1067051935 -8 Left 1067051931 10:43026612-43026634 CCTCAGGGTGACCCAGCTTGCTG No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data
1067051930_1067051935 -7 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051935 10:43026627-43026649 GCTTGCTGACGAGCAAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067051935 Original CRISPR GCTTGCTGACGAGCAAGCGG AGG Intergenic
No off target data available for this crispr