ID: 1067051936

View in Genome Browser
Species Human (GRCh38)
Location 10:43026636-43026658
Sequence CGAGCAAGCGGAGGCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067051924_1067051936 23 Left 1067051924 10:43026590-43026612 CCATCCCCAAGGTGCGCGGAGCC No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051930_1067051936 2 Left 1067051930 10:43026611-43026633 CCCTCAGGGTGACCCAGCTTGCT No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051922_1067051936 28 Left 1067051922 10:43026585-43026607 CCTTGCCATCCCCAAGGTGCGCG No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051932_1067051936 -10 Left 1067051932 10:43026623-43026645 CCCAGCTTGCTGACGAGCAAGCG No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051926_1067051936 18 Left 1067051926 10:43026595-43026617 CCCAAGGTGCGCGGAGCCCTCAG No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051927_1067051936 17 Left 1067051927 10:43026596-43026618 CCAAGGTGCGCGGAGCCCTCAGG No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051925_1067051936 19 Left 1067051925 10:43026594-43026616 CCCCAAGGTGCGCGGAGCCCTCA No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data
1067051931_1067051936 1 Left 1067051931 10:43026612-43026634 CCTCAGGGTGACCCAGCTTGCTG No data
Right 1067051936 10:43026636-43026658 CGAGCAAGCGGAGGCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067051936 Original CRISPR CGAGCAAGCGGAGGCCGAGC AGG Intergenic
No off target data available for this crispr