ID: 1067052346

View in Genome Browser
Species Human (GRCh38)
Location 10:43029146-43029168
Sequence GACCCAGCAGGGCCTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067052340_1067052346 11 Left 1067052340 10:43029112-43029134 CCAGGGGCCAAGCCAGGACAGTT No data
Right 1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG No data
1067052339_1067052346 15 Left 1067052339 10:43029108-43029130 CCAGCCAGGGGCCAAGCCAGGAC No data
Right 1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG No data
1067052343_1067052346 -1 Left 1067052343 10:43029124-43029146 CCAGGACAGTTGGATGCAGCTAG No data
Right 1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG No data
1067052342_1067052346 4 Left 1067052342 10:43029119-43029141 CCAAGCCAGGACAGTTGGATGCA No data
Right 1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067052346 Original CRISPR GACCCAGCAGGGCCTCCGCC CGG Intergenic
No off target data available for this crispr