ID: 1067052495

View in Genome Browser
Species Human (GRCh38)
Location 10:43030080-43030102
Sequence GAGGGTTGCAAGTTTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067052495_1067052506 19 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052506 10:43030122-43030144 CATGGGGGAAGAAACTGCAGGGG No data
1067052495_1067052500 1 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052500 10:43030104-43030126 TTGCTGAGCAAGTACAGGCATGG No data
1067052495_1067052504 17 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052504 10:43030120-43030142 GGCATGGGGGAAGAAACTGCAGG No data
1067052495_1067052501 2 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052501 10:43030105-43030127 TGCTGAGCAAGTACAGGCATGGG No data
1067052495_1067052502 3 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052502 10:43030106-43030128 GCTGAGCAAGTACAGGCATGGGG No data
1067052495_1067052507 30 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052507 10:43030133-43030155 AAACTGCAGGGGCCTGAGAAAGG No data
1067052495_1067052503 4 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052503 10:43030107-43030129 CTGAGCAAGTACAGGCATGGGGG No data
1067052495_1067052505 18 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052505 10:43030121-43030143 GCATGGGGGAAGAAACTGCAGGG No data
1067052495_1067052498 -4 Left 1067052495 10:43030080-43030102 CCTGAAGGAAACTTGCAACCCTC No data
Right 1067052498 10:43030099-43030121 CCTCCTTGCTGAGCAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067052495 Original CRISPR GAGGGTTGCAAGTTTCCTTC AGG (reversed) Intergenic
No off target data available for this crispr