ID: 1067053435

View in Genome Browser
Species Human (GRCh38)
Location 10:43038192-43038214
Sequence CACAATAAGCACAGTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067053435_1067053439 24 Left 1067053435 10:43038192-43038214 CCAAGCTCACTGTGCTTATTGTG No data
Right 1067053439 10:43038239-43038261 TTCCATACAGCACTGCCACTGGG No data
1067053435_1067053441 30 Left 1067053435 10:43038192-43038214 CCAAGCTCACTGTGCTTATTGTG No data
Right 1067053441 10:43038245-43038267 ACAGCACTGCCACTGGGACTTGG No data
1067053435_1067053438 23 Left 1067053435 10:43038192-43038214 CCAAGCTCACTGTGCTTATTGTG No data
Right 1067053438 10:43038238-43038260 CTTCCATACAGCACTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067053435 Original CRISPR CACAATAAGCACAGTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr