ID: 1067055086

View in Genome Browser
Species Human (GRCh38)
Location 10:43045446-43045468
Sequence CAGGCCCTGGATGCTGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067055086_1067055098 27 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055086_1067055093 -10 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055093 10:43045459-43045481 CCAGGGCCTGCATCTGTGTGGGG No data
1067055086_1067055094 -9 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055094 10:43045460-43045482 CAGGGCCTGCATCTGTGTGGGGG No data
1067055086_1067055099 28 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055099 10:43045497-43045519 GATCCTACTGCCTGAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067055086 Original CRISPR CAGGCCCTGGATGCTGCCGG GGG (reversed) Intergenic
No off target data available for this crispr