ID: 1067055093

View in Genome Browser
Species Human (GRCh38)
Location 10:43045459-43045481
Sequence CCAGGGCCTGCATCTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067055086_1067055093 -10 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055093 10:43045459-43045481 CCAGGGCCTGCATCTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067055093 Original CRISPR CCAGGGCCTGCATCTGTGTG GGG Intergenic
No off target data available for this crispr