ID: 1067055094

View in Genome Browser
Species Human (GRCh38)
Location 10:43045460-43045482
Sequence CAGGGCCTGCATCTGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067055087_1067055094 -10 Left 1067055087 10:43045447-43045469 CCCCGGCAGCATCCAGGGCCTGC No data
Right 1067055094 10:43045460-43045482 CAGGGCCTGCATCTGTGTGGGGG No data
1067055086_1067055094 -9 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055094 10:43045460-43045482 CAGGGCCTGCATCTGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067055094 Original CRISPR CAGGGCCTGCATCTGTGTGG GGG Intergenic
No off target data available for this crispr