ID: 1067055098

View in Genome Browser
Species Human (GRCh38)
Location 10:43045496-43045518
Sequence TGATCCTACTGCCTGAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067055086_1067055098 27 Left 1067055086 10:43045446-43045468 CCCCCGGCAGCATCCAGGGCCTG No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055092_1067055098 14 Left 1067055092 10:43045459-43045481 CCAGGGCCTGCATCTGTGTGGGG No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055089_1067055098 24 Left 1067055089 10:43045449-43045471 CCGGCAGCATCCAGGGCCTGCAT No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055095_1067055098 8 Left 1067055095 10:43045465-43045487 CCTGCATCTGTGTGGGGGTCAAG No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055088_1067055098 25 Left 1067055088 10:43045448-43045470 CCCGGCAGCATCCAGGGCCTGCA No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data
1067055087_1067055098 26 Left 1067055087 10:43045447-43045469 CCCCGGCAGCATCCAGGGCCTGC No data
Right 1067055098 10:43045496-43045518 TGATCCTACTGCCTGAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067055098 Original CRISPR TGATCCTACTGCCTGAGCAG CGG Intergenic
No off target data available for this crispr