ID: 1067057285

View in Genome Browser
Species Human (GRCh38)
Location 10:43059560-43059582
Sequence TGTCTCTCCTCTCAGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067057285_1067057297 21 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057297 10:43059604-43059626 GGTCTCAGGGGTCCCATAAGGGG No data
1067057285_1067057300 26 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data
1067057285_1067057299 25 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057299 10:43059608-43059630 TCAGGGGTCCCATAAGGGGGTGG No data
1067057285_1067057295 19 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057295 10:43059602-43059624 GAGGTCTCAGGGGTCCCATAAGG No data
1067057285_1067057291 8 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057291 10:43059591-43059613 AGCCTGGCCTCGAGGTCTCAGGG No data
1067057285_1067057289 0 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057289 10:43059583-43059605 CATCGCAGAGCCTGGCCTCGAGG No data
1067057285_1067057296 20 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057296 10:43059603-43059625 AGGTCTCAGGGGTCCCATAAGGG No data
1067057285_1067057292 9 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057292 10:43059592-43059614 GCCTGGCCTCGAGGTCTCAGGGG No data
1067057285_1067057298 22 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057298 10:43059605-43059627 GTCTCAGGGGTCCCATAAGGGGG No data
1067057285_1067057288 -8 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057288 10:43059575-43059597 GAGAGACACATCGCAGAGCCTGG No data
1067057285_1067057290 7 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057290 10:43059590-43059612 GAGCCTGGCCTCGAGGTCTCAGG No data
1067057285_1067057301 27 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057301 10:43059610-43059632 AGGGGTCCCATAAGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067057285 Original CRISPR TGTCTCTCCTCTCAGATGTG GGG (reversed) Intergenic
No off target data available for this crispr