ID: 1067057293

View in Genome Browser
Species Human (GRCh38)
Location 10:43059593-43059615
Sequence ACCCCTGAGACCTCGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067057293_1067057301 -6 Left 1067057293 10:43059593-43059615 CCTGGCCTCGAGGTCTCAGGGGT No data
Right 1067057301 10:43059610-43059632 AGGGGTCCCATAAGGGGGTGGGG No data
1067057293_1067057300 -7 Left 1067057293 10:43059593-43059615 CCTGGCCTCGAGGTCTCAGGGGT No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data
1067057293_1067057302 -1 Left 1067057293 10:43059593-43059615 CCTGGCCTCGAGGTCTCAGGGGT No data
Right 1067057302 10:43059615-43059637 TCCCATAAGGGGGTGGGGCTAGG No data
1067057293_1067057299 -8 Left 1067057293 10:43059593-43059615 CCTGGCCTCGAGGTCTCAGGGGT No data
Right 1067057299 10:43059608-43059630 TCAGGGGTCCCATAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067057293 Original CRISPR ACCCCTGAGACCTCGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr