ID: 1067057300

View in Genome Browser
Species Human (GRCh38)
Location 10:43059609-43059631
Sequence CAGGGGTCCCATAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067057286_1067057300 25 Left 1067057286 10:43059561-43059583 CCCACATCTGAGAGGAGAGACAC No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data
1067057287_1067057300 24 Left 1067057287 10:43059562-43059584 CCACATCTGAGAGGAGAGACACA No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data
1067057293_1067057300 -7 Left 1067057293 10:43059593-43059615 CCTGGCCTCGAGGTCTCAGGGGT No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data
1067057285_1067057300 26 Left 1067057285 10:43059560-43059582 CCCCACATCTGAGAGGAGAGACA No data
Right 1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067057300 Original CRISPR CAGGGGTCCCATAAGGGGGT GGG Intergenic
No off target data available for this crispr