ID: 1067057479

View in Genome Browser
Species Human (GRCh38)
Location 10:43060703-43060725
Sequence CTAGAGAAGCAGAGTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067057465_1067057479 16 Left 1067057465 10:43060664-43060686 CCGGGAGGAGGCTGCATGACCCA No data
Right 1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG No data
1067057472_1067057479 -3 Left 1067057472 10:43060683-43060705 CCCAGGGTGGGGAGGCCGACCTA No data
Right 1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG No data
1067057473_1067057479 -4 Left 1067057473 10:43060684-43060706 CCAGGGTGGGGAGGCCGACCTAG No data
Right 1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067057479 Original CRISPR CTAGAGAAGCAGAGTGGGGC AGG Intergenic
No off target data available for this crispr