ID: 1067062455

View in Genome Browser
Species Human (GRCh38)
Location 10:43084830-43084852
Sequence AACCGCCCTGTGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067062447_1067062455 18 Left 1067062447 10:43084789-43084811 CCATGGTGTCACTGCTTGTGCAT 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1067062455 10:43084830-43084852 AACCGCCCTGTGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067062455 Original CRISPR AACCGCCCTGTGAAGGATGG AGG Intronic
No off target data available for this crispr