ID: 1067063438

View in Genome Browser
Species Human (GRCh38)
Location 10:43089900-43089922
Sequence CAGGACTTGGGGCAGAGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067063429_1067063438 11 Left 1067063429 10:43089866-43089888 CCTGAGAGTTAAGGGAGGCAAAG 0: 1
1: 0
2: 0
3: 23
4: 225
Right 1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG No data
1067063428_1067063438 12 Left 1067063428 10:43089865-43089887 CCCTGAGAGTTAAGGGAGGCAAA 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067063438 Original CRISPR CAGGACTTGGGGCAGAGATC GGG Intronic
No off target data available for this crispr