ID: 1067065198

View in Genome Browser
Species Human (GRCh38)
Location 10:43100569-43100591
Sequence GAGGTGCCCAGCTTCCGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067065191_1067065198 -3 Left 1067065191 10:43100549-43100571 CCCTGCGGGACGCCCCTGAGGAG 0: 1
1: 0
2: 1
3: 5
4: 92
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1067065185_1067065198 16 Left 1067065185 10:43100530-43100552 CCCTTGCTGTACGTCCATGCCCT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1067065192_1067065198 -4 Left 1067065192 10:43100550-43100572 CCTGCGGGACGCCCCTGAGGAGG 0: 1
1: 0
2: 2
3: 5
4: 107
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1067065186_1067065198 15 Left 1067065186 10:43100531-43100553 CCTTGCTGTACGTCCATGCCCTG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1067065189_1067065198 2 Left 1067065189 10:43100544-43100566 CCATGCCCTGCGGGACGCCCCTG 0: 1
1: 0
2: 3
3: 20
4: 215
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159
1067065184_1067065198 24 Left 1067065184 10:43100522-43100544 CCGGCACGCCCTTGCTGTACGTC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067065198 Original CRISPR GAGGTGCCCAGCTTCCGCCT GGG Exonic
900158068 1:1211522-1211544 GCGGGGCCCAGCGTCCACCTTGG + Exonic
900265708 1:1756032-1756054 GGGGTGGCCAGCGCCCGCCTGGG - Intronic
900397869 1:2460641-2460663 GAGCAGCCCAGCTTACACCTGGG - Intronic
901687046 1:10948731-10948753 GAGGTCCCCAGCCTCCCCCAGGG - Exonic
910028626 1:82688976-82688998 GTTGTGACCAGCTTCCACCTTGG + Intergenic
911591715 1:99755323-99755345 AAGGAGCCCATCTTCCACCTCGG - Intronic
916065615 1:161133162-161133184 GTGGTGCCCAGATCCCGTCTCGG + Intergenic
916824160 1:168428346-168428368 AAGGTGCCCAGCTTGTGCCTTGG - Intergenic
919465351 1:197918014-197918036 GGGGTGCCCGGCTACCGCCGCGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922180254 1:223227785-223227807 GAGGTGCCGAGGTTCCCCGTGGG + Intronic
923035242 1:230280889-230280911 GAGGTGCCTGGCTTCTACCTGGG + Exonic
923623272 1:235594786-235594808 GAGGGAGCCAGCTCCCGCCTTGG + Intronic
1063309346 10:4937785-4937807 GAGGGAGCCAGCTTCAGCCTTGG + Intronic
1063686353 10:8240472-8240494 GAGGTGTCCAGCATCCGGATGGG + Intergenic
1064308737 10:14192080-14192102 AAGGTGCACAGCTACCTCCTTGG + Intronic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1069947298 10:71996808-71996830 GAGGAGCCCAGCTCTTGCCTCGG - Intronic
1070742793 10:78913617-78913639 GAAGGGCCCAGCTGCCTCCTGGG + Intergenic
1071986220 10:91053534-91053556 GAGGTGCCCAGCCTGCTCCTGGG + Intergenic
1072530357 10:96313009-96313031 CAGGTGCCCAGCTTGGTCCTTGG - Intronic
1073430160 10:103480681-103480703 GAGGATCCCAGCTTCCTCCCTGG - Intergenic
1074889106 10:117720482-117720504 GAGTTGCCCAGACTCAGCCTGGG - Intergenic
1075093503 10:119456445-119456467 GAGGTGGCCAGCTGCTCCCTGGG - Intronic
1076796298 10:132799973-132799995 GAGGTGCCCGTCTTCCACCTGGG + Intergenic
1078272327 11:9807623-9807645 GAGGACCCCAGCTTGTGCCTGGG - Intronic
1079623047 11:22578549-22578571 GAGGAGCCAAGCTTCAGCCTTGG - Intergenic
1084052017 11:66606151-66606173 GAAGTCCCCATCTTCCTCCTTGG + Intergenic
1084223073 11:67696808-67696830 GAGGTGCCCAGGTGCAGCCTGGG - Intergenic
1084329130 11:68419927-68419949 GAGGTGCACAACTTGAGCCTGGG - Intronic
1088648082 11:111933366-111933388 GATCTGCCCGCCTTCCGCCTTGG + Intronic
1089160202 11:116431604-116431626 AAGGAGCCCAGGTTCTGCCTTGG + Intergenic
1090815927 11:130295538-130295560 GAGGTGCCCAGCCTGCCCCTGGG + Intronic
1091564048 12:1634818-1634840 CCGTTGCCCAGCTTCTGCCTAGG + Intronic
1094454488 12:30617032-30617054 GCCGTGGCCAGCTTCTGCCTTGG - Intergenic
1094722284 12:33076915-33076937 GAGGTGCCCACAATCCTCCTAGG - Intergenic
1095099167 12:38163198-38163220 CAGGTGCCCAGCTCCAGCCGGGG - Intergenic
1096202576 12:49695891-49695913 GAGCTTCCCAGCATCTGCCTGGG - Intronic
1096514145 12:52147110-52147132 CAGGAGCCCAGCTTCCCCATGGG - Intergenic
1096616910 12:52838441-52838463 GATGTGCTCAGCTTGTGCCTGGG - Intronic
1097721130 12:63022796-63022818 GTGGTTCCCAACTTCCTCCTAGG - Intergenic
1104040833 12:125129483-125129505 GAGCTGGCCAGCCTCTGCCTTGG + Intronic
1104455526 12:128908566-128908588 GAGCTGCCAGTCTTCCGCCTTGG - Intronic
1106208579 13:27621109-27621131 CAGGCGCCCAGCCCCCGCCTCGG - Exonic
1106475453 13:30094382-30094404 GAGGAGGCCAGCTTTTGCCTGGG + Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1106580165 13:31010845-31010867 GAGGTCCCCAGCTACCTCCAGGG - Intergenic
1113335053 13:109369682-109369704 CAGGTGCCCAGCTTCCCACTCGG - Intergenic
1113694307 13:112333073-112333095 GAGGTGCCCAGCTGTGGCGTGGG - Intergenic
1114696326 14:24630739-24630761 ATGGTGCTCAGCTTCAGCCTTGG + Intergenic
1118790161 14:69083863-69083885 GAGATGCCCAGCCTGCCCCTGGG + Intronic
1121278058 14:92681005-92681027 AAGGTGCCCAGCAGCTGCCTGGG - Intronic
1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG + Intergenic
1122883818 14:104701781-104701803 CAGGTCCCCAGCGTCCGCCTGGG - Intronic
1127344207 15:58078378-58078400 GAGATCCCCAGGTTCCTCCTGGG + Intronic
1129890735 15:79070084-79070106 GGGGTGCCTTGCTTCTGCCTGGG + Intronic
1130770319 15:86917350-86917372 TTGGGGCCCAGCTTCCTCCTAGG + Intronic
1132291281 15:100705505-100705527 GGCATGCCCAGCTTCCTCCTGGG - Intergenic
1132709565 16:1260330-1260352 GAGAGGCCCAGCCTCCGCATGGG - Intergenic
1132758235 16:1496295-1496317 GAGGGGCCCGGCTTCCTCCTGGG - Intronic
1133218533 16:4307870-4307892 GGCGCCCCCAGCTTCCGCCTCGG + Intergenic
1133590817 16:7241316-7241338 GAGGTGACCTGCTTCCTGCTTGG - Intronic
1134726429 16:16422058-16422080 AAGGTGCCCAGGGTCGGCCTCGG - Intergenic
1134941002 16:18289801-18289823 AAGGTGCCCAGGGTCGGCCTCGG + Intergenic
1136569734 16:31089406-31089428 GCGGTGCCCACCTTCCTCATAGG + Intronic
1138482543 16:57313156-57313178 GAGGGGCCCAGCTTTGGCCGGGG + Intergenic
1139839727 16:69868519-69868541 GAGGGGTCCAGCTTGCTCCTGGG + Intronic
1141563919 16:84888528-84888550 GAGGTACCCAGCTGCTCCCTTGG + Intronic
1143554244 17:7650934-7650956 GAGGAGCGGAGCCTCCGCCTGGG + Intronic
1143614871 17:8043771-8043793 GAGGTCCCCAGGCTCCGGCTGGG + Intronic
1143764812 17:9130516-9130538 GGGGTGGCCAGCTGCCTCCTGGG + Intronic
1143810705 17:9469121-9469143 GAGCTGCCCAGCCTTCTCCTAGG - Intronic
1145746630 17:27324932-27324954 GAGTTTCCCAGCTTCCTCCTTGG - Intergenic
1147606619 17:41777310-41777332 GCTGAGCCCAGCTTCCCCCTGGG - Intronic
1151726901 17:75890703-75890725 GAGCTGCCCAGCTTCAGCTTGGG - Exonic
1152132984 17:78488429-78488451 GAGGTGTCCAGTTCCTGCCTTGG + Intronic
1152189188 17:78878187-78878209 TAAGTGCCCAGCTGCCACCTGGG - Intronic
1156213016 18:34967506-34967528 CTGGTGACCAGCTTCCGTCTAGG + Intergenic
1156308923 18:35904958-35904980 GGGCTGCCCAGCTTCTGCTTGGG + Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG + Exonic
927481044 2:23454201-23454223 CAGGGGCCCAGCTTTCTCCTCGG - Intronic
928688507 2:33775305-33775327 GAGGGAGCCAGCTTCGGCCTTGG - Intergenic
929904249 2:46032385-46032407 CTGGCACCCAGCTTCCGCCTGGG + Intronic
931976157 2:67646493-67646515 GATGTGACCTGCTTCCACCTTGG + Intergenic
936111855 2:109671276-109671298 GAGGTGGCCAGCTGCAGCCAGGG + Intergenic
936559081 2:113520794-113520816 GAGGAGCACAGCTTCTGCCTTGG - Intergenic
936933946 2:117819762-117819784 GAGGTGCCCAGTCTGCCCCTGGG + Exonic
939879499 2:147613843-147613865 GAGGAGCCCTCCTTCAGCCTTGG + Intergenic
940980817 2:160000479-160000501 GAGGAGCCCAACTTCACCCTGGG + Intronic
948427379 2:237896386-237896408 GAGGCGCCCAGATTCCTCCCCGG + Intronic
948625015 2:239263412-239263434 CAGGTGAACAGCTTCCCCCTCGG + Intronic
948720693 2:239898325-239898347 GAGGTGCTCAGCCTGCGCCCGGG + Intronic
948834769 2:240620618-240620640 GTGGTGCCCAGCTCCTGCCAAGG + Intronic
1168814738 20:728698-728720 GAGGGGCCCAGCTCCCGACAGGG - Intergenic
1169444150 20:5657382-5657404 GTGCTGCCCAGATTCCTCCTCGG - Intergenic
1171457466 20:25280156-25280178 GGGGTACCCAGCATCTGCCTGGG + Intronic
1173625241 20:44467540-44467562 GAGGTGGCCAGCTTCGTTCTAGG + Intergenic
1175803270 20:61813239-61813261 GAGGTCCCCAGCTTCGGGCCGGG + Intronic
1175998581 20:62822038-62822060 GAGGTGCCCGGCTTCTCCCAGGG - Intronic
1176177903 20:63737349-63737371 GAGGTGCCCACCTTCTGGCGGGG - Intronic
1180020808 21:45125389-45125411 GAGGTGGCTGGCTCCCGCCTGGG + Intronic
1180177229 21:46096784-46096806 GAGGGGCCTGGCTTCCCCCTGGG + Intergenic
1182235457 22:28872304-28872326 GAGGTGCCCAGCCTCCTACACGG - Intergenic
1183084485 22:35478194-35478216 GAGCTGGCCGGCCTCCGCCTTGG + Intergenic
1184321783 22:43747478-43747500 GTGGCGCCCAGTTTCTGCCTTGG + Intronic
1184408383 22:44312997-44313019 CAGGAGTCCAGCTCCCGCCTGGG + Intergenic
1184905946 22:47486758-47486780 GATGTTCCCAGCCTCCCCCTGGG - Exonic
1185041416 22:48506345-48506367 GAGGTGCCCATGTTCCCCCATGG - Intronic
1185051035 22:48554078-48554100 GAAGAGCTCAGCTCCCGCCTGGG + Intronic
1185314754 22:50174233-50174255 GAGGGACCCAGCTTCACCCTTGG + Intronic
949944416 3:9178753-9178775 GAGGGGCACAGCTTCTCCCTAGG - Intronic
951332993 3:21387613-21387635 GAGGGAGCCAGCTTCGGCCTTGG + Intergenic
954214522 3:49117041-49117063 CAGGTGCCCAGCTCTCACCTGGG + Exonic
955202368 3:56862524-56862546 GGGGGGCCCAGATTCAGCCTTGG - Intronic
955922992 3:63977635-63977657 GAGGTGCCCTGCTTCACTCTGGG + Intronic
956867445 3:73383993-73384015 GCGCTGCCCAGCTTCTGGCTGGG + Exonic
957161078 3:76610418-76610440 GGGGTGAGCAGCTTCCACCTTGG + Intronic
959212411 3:103403420-103403442 TAGATCCCCAGCTTCCTCCTGGG - Intergenic
959537532 3:107503508-107503530 GAGGTGGCCAGCAACTGCCTTGG + Intergenic
960150639 3:114245589-114245611 GAGGTGCCCAGGTACAGCTTGGG + Intergenic
961416042 3:126757796-126757818 GGGGTGCCCAGCTGCCGACAGGG + Intronic
968131379 3:196194641-196194663 GAGGTCCCCAGCTGGCCCCTAGG - Intergenic
969519443 4:7667406-7667428 GCTGTGCCCAGCTTCATCCTAGG + Intronic
972679053 4:41288135-41288157 GCGGTGACCAGCTTCTGCCTTGG + Intergenic
976846024 4:89490013-89490035 GAGGGAGCCAGCTTCGGCCTTGG - Intergenic
977123469 4:93133662-93133684 AATGTGCCCAGCATCTGCCTAGG - Intronic
978285477 4:107073054-107073076 GAGGGAGCCGGCTTCCGCCTTGG - Intronic
984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG + Intronic
992996261 5:82336743-82336765 GAGGAGCCCAGCTTCTTCCCAGG - Intronic
993239926 5:85369060-85369082 GCTGTGACCAGCTTCCACCTTGG - Intergenic
994345416 5:98679880-98679902 GAGGTGCCCAGCCTGCCCCTGGG + Intergenic
994589739 5:101758683-101758705 GAGGTGCCCAGCATGCGCACAGG - Intergenic
997228942 5:132228846-132228868 GAGATGCCCAGCCTCCGCCCAGG + Intronic
1001156866 5:169280119-169280141 AAGCTGCCCAGCTTCCGCTGGGG + Intronic
1002098761 5:176847085-176847107 TGGGTGCCCCGCTCCCGCCTGGG + Intronic
1003545258 6:7052694-7052716 GAGGCGGCCAGCTCCAGCCTTGG + Intergenic
1004731601 6:18364918-18364940 GAGGTGCCCAGCCTGCCCCTGGG - Intergenic
1006382281 6:33706534-33706556 CAGGTGCCCAACTCCCACCTCGG - Intronic
1009521941 6:64694412-64694434 GAGTTGCCCAGCTTCCCAGTGGG - Intronic
1010878908 6:81143640-81143662 GAGGTGCCCACTTTACGCCAAGG - Intergenic
1013573064 6:111449303-111449325 GAGATTGCCAGCTTCCACCTGGG - Intronic
1017119441 6:151009871-151009893 CAAGTGCCGAGCTTCCGGCTTGG + Exonic
1018109447 6:160520670-160520692 GAGGGAGCCGGCTTCCGCCTCGG + Intergenic
1019479007 7:1257476-1257498 GAGGTGCCCAGGAGCCGGCTCGG + Intergenic
1019500306 7:1361224-1361246 GAGGGGCCCAGCTTGTCCCTAGG + Intergenic
1020624106 7:10557427-10557449 GAGGTGCCCAGTCTCACCCTGGG - Intergenic
1020762925 7:12290188-12290210 GCTGTGACCAGCTTCCACCTTGG - Intergenic
1022611769 7:31882515-31882537 AAGGTGCCCAGCTATCCCCTAGG + Intronic
1026350243 7:69509310-69509332 GAGGTGCCCACCTTCCCACTCGG + Intergenic
1028303342 7:89229131-89229153 GAGGGACCCAGCTCCGGCCTTGG + Intronic
1029422230 7:100477632-100477654 GAGCTGGCCAGCCTCGGCCTGGG - Exonic
1034979185 7:155465552-155465574 CAGAGGCCCCGCTTCCGCCTGGG - Intergenic
1038166410 8:25088925-25088947 AAGGGGCACAGCTTCTGCCTAGG + Intergenic
1039890684 8:41683491-41683513 CAGGTGCCCACCCTCAGCCTGGG + Intronic
1040806884 8:51405182-51405204 GAGGGAGCCGGCTTCCGCCTGGG + Intronic
1049323914 8:142011970-142011992 GAGGTCCACAGCTTCTGCCCTGG - Intergenic
1049336822 8:142091047-142091069 GAGGTCCCCAGCTGCCTTCTGGG + Intergenic
1049893771 9:95387-95409 GAGGAGAACAGCTTCTGCCTTGG + Intergenic
1053734996 9:41095471-41095493 GAGGAGCACAGCTTCTGCCTTGG + Intergenic
1054693386 9:68335926-68335948 GAGGAGCACAGCTTCTGCCTTGG - Intronic
1055023611 9:71695714-71695736 GAACTACCCAGCTTCCGACTTGG - Intronic
1056338455 9:85601099-85601121 CAGGTCCCCAGCTGTCGCCTGGG + Intronic
1058931807 9:109727798-109727820 GAGATGCCCAGCTTCATGCTTGG + Intronic
1060720312 9:125972191-125972213 CAGGTGGCCTGCTTCCGTCTGGG + Intergenic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1061236971 9:129349022-129349044 GAGGGCCCCAGCTTGGGCCTGGG + Intergenic
1062105223 9:134751458-134751480 GAGGAGCCCAGCTCCAGCCCAGG - Intronic
1062250612 9:135591964-135591986 GTGGAGCTCACCTTCCGCCTGGG - Intergenic
1062263764 9:135677191-135677213 CAGGTGTCCAGCTCCCGCCCAGG + Intergenic
1062514268 9:136924606-136924628 GGGGTGCCCAGCTTTAGCCCAGG + Intronic
1186221472 X:7354019-7354041 GAAGTGCCCAGATTGGGCCTGGG - Exonic
1186295686 X:8145311-8145333 GAGGGAGCCAGCTTCAGCCTTGG + Intergenic
1191252673 X:58266968-58266990 GAGGAGCCTAGCCTCCTCCTCGG + Intergenic
1192448440 X:71227429-71227451 GAGGTTCCCTGCTTCCGACCAGG - Intergenic
1195038281 X:100990180-100990202 GAGGTGCCCATCCTCTGCCCTGG - Intronic
1199599420 X:149533126-149533148 GAAGGGCCCAGCATCTGCCTTGG - Exonic
1199651213 X:149947081-149947103 GAAGGGCCCAGCATCTGCCTTGG + Intergenic
1200292473 X:154886290-154886312 GACGTGCCCTGCGTCCCCCTCGG - Intronic
1200339317 X:155382030-155382052 GACGTGCCCTGCGTCCCCCTCGG - Intergenic
1200347153 X:155458663-155458685 GACGTGCCCTGCGTCCCCCTCGG + Exonic