ID: 1067066100

View in Genome Browser
Species Human (GRCh38)
Location 10:43105142-43105164
Sequence TGGCGGTGTCGACGCCCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066100_1067066110 7 Left 1067066100 10:43105142-43105164 CCCCGCGGGCGTCGACACCGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1067066110 10:43105172-43105194 GGTGGAGTTCAAGCGGAAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 148
1067066100_1067066111 29 Left 1067066100 10:43105142-43105164 CCCCGCGGGCGTCGACACCGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066100_1067066107 0 Left 1067066100 10:43105142-43105164 CCCCGCGGGCGTCGACACCGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1067066107 10:43105165-43105187 GCGCCGTGGTGGAGTTCAAGCGG 0: 1
1: 0
2: 0
3: 4
4: 37
1067066100_1067066109 4 Left 1067066100 10:43105142-43105164 CCCCGCGGGCGTCGACACCGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1067066109 10:43105169-43105191 CGTGGTGGAGTTCAAGCGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066100 Original CRISPR TGGCGGTGTCGACGCCCGCG GGG (reversed) Exonic
902475750 1:16686055-16686077 TGGCGGTGGCGGCGACCTCGCGG + Intergenic
905648289 1:39639713-39639735 GGGCGGTGGCGGCGCCCCCGAGG - Exonic
906102653 1:43273049-43273071 TGGAGGGGCCGACGCCCTCGTGG + Exonic
915359572 1:155277912-155277934 TCCCGGTGTCGCTGCCCGCGAGG - Intronic
917345174 1:174022134-174022156 CGGCGGTGGCGACGGCCGCGGGG - Exonic
919805519 1:201379048-201379070 TGGCAGTGTGGAGGCCCACGTGG - Intronic
1067066100 10:43105142-43105164 TGGCGGTGTCGACGCCCGCGGGG - Exonic
1073110609 10:101061254-101061276 TGGCGGTGGTGGCGGCCGCGAGG + Intergenic
1077541607 11:3149202-3149224 TGGTGGTGTGGACGCTCGGGGGG - Intronic
1100260618 12:92929190-92929212 AGGCGGTGGCGACGGCCGCTCGG + Exonic
1103331070 12:120154399-120154421 TGGCCGTGTCCACTCCCGTGAGG - Intronic
1103509763 12:121466729-121466751 AGGAGGTGCCGGCGCCCGCGGGG + Intronic
1112692995 13:101916978-101917000 TGGCGGTGGCGACCCCCGCCGGG - Intronic
1122108729 14:99480694-99480716 CGGCGGTCTCTGCGCCCGCGCGG - Intronic
1122486618 14:102086644-102086666 TGGCGGAGCCGCAGCCCGCGCGG - Intronic
1134143656 16:11742926-11742948 GGGCGGTGTCGGTGCCCGCCCGG - Intergenic
1135335849 16:21600048-21600070 TCGCGGAGTCGACGCCCGGCGGG - Intronic
1136294610 16:29294578-29294600 TGGCGGTGCCAACCCCTGCGGGG - Intergenic
1142100516 16:88268622-88268644 TGGCGGTGCCAACCCCCACGGGG - Intergenic
1142413142 16:89926222-89926244 AGGCGGTGCCGCAGCCCGCGCGG - Intronic
1160968639 19:1757684-1757706 TGGCGGGGGCGAGGGCCGCGGGG + Intronic
1162758336 19:12873795-12873817 TGGCGGCGGTGACGCCTGCGTGG - Exonic
1165778291 19:38417771-38417793 TGGGGGTCTCGACGTCCGCCTGG - Intronic
1167578368 19:50328443-50328465 CGGCGTTGGCGGCGCCCGCGGGG + Exonic
1168719061 19:58544894-58544916 CCGCGGCGTCGTCGCCCGCGGGG + Exonic
934661385 2:96145410-96145432 TGGCGGTGGCGCTGCCCGAGCGG + Exonic
942455693 2:176136807-176136829 AGGCGGTGTCGGCGCCGGCGGGG - Intergenic
945189029 2:207166931-207166953 CGGCGGCGGCGGCGCCCGCGGGG - Intronic
946304251 2:218846854-218846876 TGGGGGTGTCGCCCCCCGCCCGG + Intergenic
946322087 2:218960153-218960175 TGGCGGTGCCGCCGCCGTCGGGG - Exonic
1170026171 20:11891293-11891315 TGGCCGTGCGGACGCCCGCGGGG + Intronic
1176041439 20:63067947-63067969 CGGGGGTCTCGACGCCCCCGCGG - Intergenic
1179508033 21:41854776-41854798 TGGAGGTGTCGAAGCACACGGGG + Exonic
1183441444 22:37825282-37825304 TGGCGGCGTCGGCGGCCGCACGG - Exonic
967870604 3:194225878-194225900 TGGAGGTGGCAACGCCCGCTGGG - Intergenic
968518320 4:1024058-1024080 TGGCGTTGATGGCGCCCGCGCGG - Exonic
984823828 4:183906646-183906668 TGGCGGTGTAGACGCCGACGAGG + Exonic
1002621973 5:180494461-180494483 TGGCGGCGGCGACGGCGGCGCGG + Exonic
1004924337 6:20403326-20403348 TGGCAGCGGCGGCGCCCGCGTGG + Intronic
1006293982 6:33161706-33161728 TGGCCGTCTAGACGCCCACGTGG + Intergenic
1015305399 6:131701188-131701210 AGGCGATGTCGACGACCGCCAGG + Exonic
1018615950 6:165687136-165687158 TGGGGGTGTAGGCGGCCGCGTGG - Intronic
1020099856 7:5388746-5388768 AGACGGTGTAGACGCCGGCGGGG + Exonic
1023621543 7:42078151-42078173 TGGCGGTGTTGCCGACCTCGGGG - Intronic
1033300077 7:140177288-140177310 TGGCGGTGGCGGCGGGCGCGCGG + Intergenic
1033722280 7:144074411-144074433 AGGCGATGTCGACGACCGCCAGG - Exonic
1033739509 7:144259415-144259437 AGGCGATGTCGACGACCGCCAGG + Exonic
1034195018 7:149239780-149239802 TGGCGGAGTCGGCGCCTGCTCGG + Exonic
1041690055 8:60679279-60679301 CGCCGGCGTCGCCGCCCGCGGGG + Intronic
1049641095 8:143716356-143716378 TGGCGGCCAGGACGCCCGCGGGG - Exonic
1056475272 9:86946737-86946759 CGGCGGCGGCGAGGCCCGCGGGG - Exonic
1187535909 X:20141640-20141662 TGGCGGTGGCGGCGACCTCGCGG + Exonic
1200238096 X:154478825-154478847 CGGCTGTGTCCACGCCCCCGCGG + Exonic