ID: 1067066101

View in Genome Browser
Species Human (GRCh38)
Location 10:43105143-43105165
Sequence CTGGCGGTGTCGACGCCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066101_1067066110 6 Left 1067066101 10:43105143-43105165 CCCGCGGGCGTCGACACCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1067066110 10:43105172-43105194 GGTGGAGTTCAAGCGGAAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 148
1067066101_1067066111 28 Left 1067066101 10:43105143-43105165 CCCGCGGGCGTCGACACCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066101_1067066107 -1 Left 1067066101 10:43105143-43105165 CCCGCGGGCGTCGACACCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1067066107 10:43105165-43105187 GCGCCGTGGTGGAGTTCAAGCGG 0: 1
1: 0
2: 0
3: 4
4: 37
1067066101_1067066109 3 Left 1067066101 10:43105143-43105165 CCCGCGGGCGTCGACACCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1067066109 10:43105169-43105191 CGTGGTGGAGTTCAAGCGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066101 Original CRISPR CTGGCGGTGTCGACGCCCGC GGG (reversed) Exonic
901633062 1:10657252-10657274 CTGGCGGTGGCGGCGGCGGCTGG - Intronic
917345175 1:174022135-174022157 GCGGCGGTGGCGACGGCCGCGGG - Exonic
1067066101 10:43105143-43105165 CTGGCGGTGTCGACGCCCGCGGG - Exonic
1073042743 10:100618467-100618489 CTGGTGGTGCCGAGGCCCACAGG - Intergenic
1088078352 11:105879012-105879034 CTGGTGGTGTAGACACCCGAGGG + Intronic
1091473833 12:753109-753131 CTCGCGGTGCCGCCGCCCTCTGG + Exonic
1097281069 12:57845866-57845888 CTGGCGGTGACGGCGTCCGGCGG - Intronic
1101813704 12:108129601-108129623 GAGGCGGTGGCGACGCCAGCCGG - Intronic
1103509762 12:121466728-121466750 CAGGAGGTGCCGGCGCCCGCGGG + Intronic
1109033804 13:57229964-57229986 CTGGTGGTGTAGACACCCGAAGG - Intergenic
1112692996 13:101916979-101917001 GTGGCGGTGGCGACCCCCGCCGG - Intronic
1121796640 14:96741510-96741532 CTGCTGGTGCCGACACCCGCAGG + Intergenic
1129644863 15:77420312-77420334 CTGGCGGTGACTCCTCCCGCTGG - Intergenic
1135335850 16:21600049-21600071 CTCGCGGAGTCGACGCCCGGCGG - Intronic
1136289375 16:29262216-29262238 CTGGCAGTGTCGAAGCCCCGGGG + Intergenic
1136294611 16:29294579-29294601 CTGGCGGTGCCAACCCCTGCGGG - Intergenic
1140046182 16:71441835-71441857 CTGGCGCCGGCGACGCCGGCTGG - Intergenic
1141673834 16:85507125-85507147 CGGGCGTCGTCGACGCTCGCCGG + Intergenic
1142100517 16:88268623-88268645 CTGGCGGTGCCAACCCCCACGGG - Intergenic
1145878227 17:28335728-28335750 CGGGCGGAGTCGACGAGCGCAGG + Exonic
1148559231 17:48596635-48596657 CTGGCGGCCTCGCCGGCCGCTGG + Exonic
1152382073 17:79947259-79947281 CTGGCTGTGTTGACTCCTGCAGG + Intronic
932773713 2:74515071-74515093 CTGCCTGTGCCGCCGCCCGCTGG + Exonic
934503069 2:94874039-94874061 CTGGCTGTGGTGGCGCCCGCAGG - Exonic
942455694 2:176136808-176136830 CAGGCGGTGTCGGCGCCGGCGGG - Intergenic
1170026170 20:11891292-11891314 CTGGCCGTGCGGACGCCCGCGGG + Intronic
950991978 3:17449256-17449278 CTGGTGGTGTAGACACCTGCAGG - Intronic
957249617 3:77756764-77756786 CTGGCGGTGTAGGCACCCGAGGG - Intergenic
961362320 3:126375856-126375878 CTGGCGGTGTGGGCTCCTGCAGG + Intergenic
961377264 3:126475471-126475493 CTGATGGTGACGGCGCCCGCCGG + Exonic
967870605 3:194225879-194225901 CTGGAGGTGGCAACGCCCGCTGG - Intergenic
969608545 4:8214351-8214373 CTGGGTGTGTCGTCCCCCGCCGG + Intronic
972755518 4:42042078-42042100 CTGGCGGTGTAGGCACCCGAGGG - Intronic
997319161 5:132963585-132963607 CTGGCGGCGGCGACGGCAGCTGG + Exonic
998402342 5:141854238-141854260 CTGGGGCTGCCGGCGCCCGCAGG + Exonic
999726977 5:154445867-154445889 CTGGCGGCGGCGACGCCCAATGG + Intergenic
1014434688 6:121408518-121408540 GTGGCGGCGTCGACGGCGGCGGG - Intergenic
1019302991 7:318295-318317 CAGGCAGTGTCGACGGCCACAGG + Intergenic
1049173545 8:141177077-141177099 CTGGTGCTGTCCACACCCGCAGG + Intronic
1203563955 Un_KI270744v1:77902-77924 CTGGCTGTGGTGGCGCCCGCAGG - Intergenic
1186332861 X:8554456-8554478 CTGGCGGTGTAGGCACCCGAGGG - Intronic