ID: 1067066106

View in Genome Browser
Species Human (GRCh38)
Location 10:43105162-43105184
Sequence CTTGAACTCCACCACGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066106_1067066111 9 Left 1067066106 10:43105162-43105184 CCAGCGCCGTGGTGGAGTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 52
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066106 Original CRISPR CTTGAACTCCACCACGGCGC TGG (reversed) Exonic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
901238919 1:7681710-7681732 CTTGAAGTTCAGCACGGCCCTGG - Intronic
912532919 1:110339427-110339449 CTTGGACTCCGCCGCGGCACAGG - Exonic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067313194 10:45134688-45134710 CTTGAACACAACCACGGAGTTGG + Intergenic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1074228128 10:111507388-111507410 CTTAAACTCAACCACTGCCCTGG - Intergenic
1075322570 10:121503896-121503918 CATGAACTCCAACACCCCGCTGG - Exonic
1076933793 10:133554288-133554310 CTTCAACTCCACCATGTCACTGG + Intronic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG + Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1117546933 14:56801064-56801086 CTTGAACTCCACCTCTGCAGGGG - Exonic
1121359204 14:93240826-93240848 CTTGAACTCCACTGGGACGCTGG - Exonic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122635313 14:103126996-103127018 CTTCAGCTCCTCCACTGCGCCGG - Exonic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG + Exonic
1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG + Intergenic
1137910813 16:52376185-52376207 CTTGAACTCAACCACCATGCTGG - Intergenic
1138197828 16:55066714-55066736 CTTGAACTCTAATACAGCGCTGG + Intergenic
1147150436 17:38510843-38510865 CCTGGAGTCCACCAAGGCGCGGG + Exonic
1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG + Exonic
1151701011 17:75742585-75742607 CTGGAACTCCACCATGCCCCGGG - Exonic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159861116 18:73650862-73650884 CTTGGACTCCACCACAGCAGTGG - Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
928097272 2:28412418-28412440 CTTGAACTCCCCCACTCTGCTGG + Exonic
930773160 2:55147962-55147984 GTTGATCTCCACAACGGCCCTGG + Intergenic
938292437 2:130157253-130157275 TTTGAACTCCTCCAGGGGGCTGG + Exonic
938464117 2:131515723-131515745 TTTGAACTCCTCCAGGGGGCTGG - Intergenic
942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG + Intergenic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
947233220 2:227910385-227910407 CTTGAACTCCTCCTGGGCTCAGG - Intronic
1176106937 20:63393873-63393895 CTTGCACCCCAGCACAGCGCAGG - Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG + Intergenic
969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG + Intronic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
984706666 4:182852155-182852177 CTTGTAAACCATCACGGCGCTGG - Intergenic
1012548667 6:100448544-100448566 CTTGATCTCCGTGACGGCGCTGG + Exonic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG + Intronic
1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG + Intergenic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1036642813 8:10594598-10594620 CATGAACTTCTCCACGGCTCAGG - Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG + Intronic
1186448748 X:9654603-9654625 CTTGGCCTCCACCTCGGCGAGGG + Intronic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1191848899 X:65571048-65571070 GTAGAACTCCACCATGGCCCTGG - Intergenic
1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG + Intergenic